6

Q1. In the DNA molecule,

• 1) The total amount of purine nucleotides and pyrimidine nucleotides is not always equal.
• 2) There are two strands which run parallel in the 5'-3' direction.
• 3) Proportion of adenine in relation to thymine varies with the organism.
• 4) There are two strands which run antiparallel - one in 5'-3' direction and other in 3'-5' direction.

Solution

The two chains have anti-parallel polarity which means one chain has the polarity 5′-3′ while the other has 3′-5′.

Q2. Which of the following is not a termination codon?

• 1) UAG
• 2) UAA
• 3) UGA
• 4) UAC

Solution

The three translation termination codons are UAA, UAG and UGA.

Q3. The main aim of the human genome project is

• 1) To identify and sequence all the genes present in human DNA
• 2) To remove disease-causing genes from human DNA
• 3) To introduce new genes into humans
• 4) To develop better techniques for comparing two different human DNA samples

Solution

The main goal of the human genome project is to fully map and sequence all of the genetic material of humans. The human genome project is used to attain information of the human genes and their sequences. 

Q4. Some amino acids are coded by more than one codon; hence, the code is

• 1) Degenerate
• 2) Universal
• 3) Initiator
• 4) Unambiguous

Solution

The genetic code is degenerate which lacks specificity, and one amino acid often has more than one code triplet. Only methionine and tryptophan have single triplet codons. All other amino acids are specified by 2-6 base triplets.

Q5. The total number of genes present in the human genome is

• 1) 80,000
• 2) 1,40,000
• 3) 30,000
• 4) 20,000

Solution

The total number of genes in the human genome was found to be about 30,000.

Q6. A nucleoside differs from a nucleotide. It lacks the

• 1) Base
• 2) Sugar
• 3) Hydroxyl group
• 4) Phosphate group

Solution

A nucleoside differs from a nucleotide in that it lacks the phosphate group.

Q7. DNA replication in humans is

• 1) Both semi-conservative and semi-discontinuous
• 2) Semi-discontinuous
• 3) Conservative
• 4) Semi-conservative

Solution

In human DNA replication, of the two strands, one is used as a template and the other is synthesised anew, making it semi-conservative. Also, while DNA is being synthesised, one stand of the two is formed as a continuous strand and the other is in the form of fragments, making it a semi-discontinuous process as well.

Q8. DNA has genetic properties was revealed for the first time by

• 1) Avery
• 2) Chargaff
• 3) Wilkins
• 4) Griffith

Solution

In 1944, Avery, Macleod and McCarty separated the extract of smooth, virulent bacteria into protein and DNA, which gave evidence that DNA is the only genetic material in organisms.

Q9. The enzyme needed in biological systems for joining two molecules is called

• 1) Hydrolase
• 2) Diastases
• 3) Ligase
• 4) Polymerase

Solution

Ligase is an enzyme which can catalyse the joining of two large molecules. Diastase enzyme is known for breaking down any form of starch. Polymerase synthesises polymers of nucleic acids. Hydrolase catalyses the hydrolysis of proteins and nucleic acids. 

Q10. In a DNA molecule, the distance between two bases is

• 1) 3.4 nm/34 A
• 2) 0.2 nm/2 A
• 3) 0.34 nm/3.4 A
• 4) 2 nm/20 A

Solution

One complete turn of the helix is 3.4 nm and has 10 base pairs. The bases face the interior of the double helix and are attacked at the 0.34 nm (3.4 A°) position.

Q11. During the replication of DNA, the synthesis of DNA as a lagging strand takes place in segments. These segments are called

• 1) Okazaki segments
• 2) Kornberg segments
• 3) Double helix segments
• 4) Satellite segments

Solution

On the parent strand, short DNA segments are formed in the 5’-3’ direction, starting from RNA primers. These DNA fragments are known as Okazaki segments.

Q12. The term genome denotes

• 1) Bivalent
• 2) Haploid set of chromosomes
• 3) Diploid chromosomal set
• 4) Monovalent

Solution

Genome refers to a haploid set of chromosomes in a gamete or microorganisms, or in each cell of a multicellular organism.

Q13. Each species has a characteristic set of chromosome number called

• 1) Euploid
• 2) Monoploid
• 3) Aneuploid
• 4) Polyploid

Solution

Monoploid refers to the number of chromosomes of the cell, which means that the cell has only one chromosome from every one of the ‘n’ pairs (n = 23 for human cells).

Q14. mRNA direct the building of proteins through a sequence of

• 1) Codons
• 2) Anticodons
• 3) Exons
• 4) Introns

Solution

The sequences of base triplets in a DNA molecule constitute the genetic code. Three consecutive nucleotides in an mRNA strand determine the position of a single amino acid in a polypeptide chain.

Q15. In the Lac operon system, β-galactosidase is coded by

• 1) a-gene
• 2) I-gene
• 3) y-gene
• 4) z-gene

Solution

The lac operon consists of one regulatory gene (i-gene) and three structural genes (z, y, a). z-gene codes for β-galactosidase (β-gal) which is responsible for the hydrolysis of the disaccharide lactose into its monomeric units galactose and glucose.

Q16. Out of 64 codons, the number of codons with GGG is

• 1) 1
• 2) 2
• 3) 4
• 4) 6

Solution

GGG codon codes for glycine, and only a single triplet is formed when the code is deciphered.

Q17. The genetic material of a viroid is

• 1) Protein
• 2) RNA
• 3) Carbohydrate
• 4) DNA

Solution

The genetic material of a viroid is RNA. The RNA exists in a circular form, but the two sides of the circle come close together and form a double-strand-like structure, and this double-strand-like structure is significant for viroid replication.

Q18. Which of the following statements is the most appropriate for sickle cell anaemia?

• 1) It confers resistance to acquiring malaria.
• 2) All of the above.
• 3) It is a molecular disease.
• 4) It cannot be treated with iron supplements.

Solution

Sickle cell disease is caused by a genetic abnormality in the gene for haemoglobin, which results in the production of sickle haemoglobin.

Q19. What is a nucleosome?

Solution

A nucleosome is any of the repeating subunits of chromatin, consisting of a DNA chain coiled around a core of histones.

Q20. PCR and restriction fragment length polymorphism are methods for

• 1) DNA sequencing
• 2) Genetic fingerprinting
• 3) Genetic transformation
• 4) Study of enzymes

Solution

PCR can be used in DNA fingerprinting as a way to make numerous copies of isolated DNA. The process can selectively amplify a single copy of a desired sequence. Restriction fragment length polymorphism is a method where variation in DNA between individuals is revealed by restriction enzymes.  DNA is cut into fragments of different lengths in consequence of such variations. It is used forensically and in the diagnosis of hereditary disease.  

Q21. The vectors used in the Human Genome Project for cloning segments of the human DNA were

• 1) T4 phages
• 2) BACs
• 3) Both BACs and YACs
• 4) YACs

Solution

For the cloning of human DNA, both bacterial and yeast host cells were used. The cloning vectors used were BACs (bacterial artificial chromosomes) and YACs (yeast artificial chromosomes).

Q22. How did Hershey and Chase differentiate between DNA and protein in their experiment, while proving DNA is the genetic material?  

Solution

Hershey and Chase grew some bacteriophages on a medium containing radioactive phosphorus (³²P) to identify DNA and some on a medium containing radioactive sulphur (³⁵S) to identify protein. Then these radioactive-labelled phages were allowed to infect E. coli bacteria subjected to the process of centrifugation. It gave an idea that DNA acted as hereditary material which was transmitted from bacteriophage to bacteria. Bacteria which were infected with bacteriophages had radioactive proteins.

Q23. Which type of DNA molecule consists of only 8 base pairs per turn?

• 1) A-DNA
• 2) C-DNA
• 3) B-DNA
• 4) D-DNA

Solution

All A, B, C and D-DNA molecules are right-handed DNA molecules and possess 11, 10, 9 and 8 base pairs per turn, respectively.

Q24. RNA polymerase III catalyses the synthesis of which type of RNA molecule in eukaryotes?

• 1) rRNA
• 2) mRNA
• 3) tRNA
• 4) All RNA molecules

Solution

In eukaryotes, three different types of RNA polymerases are found. Each of these polymerases catalyses the formation of a different type of RNA molecule. RNA polymerase I catalyses the synthesis of rRNA, RNA polymerase II catalyses the synthesis of mRNA and RNA polymerase III catalyses the synthesis of tRNA.

Q25. Which of the following are the functions of RNA?

• 1) It is a carrier of genetic information from DNA to ribosomes synthesising polypeptides.
• 2) All of the above.
• 3) It is a constituent component of ribosomes.
• 4) It carries amino acids to ribosomes.

Solution

RNA is a type of nucleic acid which carries amino acids to ribosomes, and it also acts as genetic material.

Q26. Semi-conservative replication of DNA was first demonstrated in

• 1) Salmonella typhimurium
• 2) Drosophila melanogaster
• 3) Streptococcus pneumoniae
• 4) Escherichia coli

Solution

Meselson and Stahl first showed semiconservative replication in Escherichia coli and subsequently in higher organisms.

Q27. Mention the contribution of genetic maps in human genome project. 

Solution

(i) Genetic maps have been used to find the exact chromosomal location. (ii) They also provide information which helps to prevent inherited disease.

Q28. Why is the Human Genome Project called a mega project? 

Solution

The human genome is said to have 3 × 10⁹ bp, and the cost of sequencing was very high. It aimed at developing new technology and generating new information in the field of genomic studies. It also closely associated with the rapid development of a new area called bioinformatics. It provided clues regarding the understanding of human biology.

Q29. Who among the following scientists had no contribution in the development of the double helix model for the structure of DNA?

• 1) Rosalind Franklin
• 2) Erwin Chargaff
• 3) Meselson and Stahl
• 4) Maurice Wilkins

Solution

Meselson and Stahl proved the replication of DNA which replicates semiconservatively.

Q30. Comment on ‘the utility of variability is the number of tandem repeats during DNA fingerprinting’. 

Solution

Tandemness present in repeats supplies several copies of the sequence for fingerprinting and variations in the nitrogen base sequence in them. It is useful for identification of individuals and their relation by DNA fingerprinting.

Q31. There is a paternity dispute for a child. Which technique can solve the problem? 

Solution

A paternity dispute for a child can be solved by the process of DNA fingerprinting.

Q32. Phages which show a lysogenic cycle are known as

• 1) Virulent phages
• 2) Avirulent phages
• 3) Lytic phages
• 4) Temperate phages

Solution

Temperate phages

Q33. That the mode of DNA replication is semiconservative was demonstrated by

• 1) Watson and Crick
• 2) Taylor
• 3) Khorana
• 4) Meselson and Stahl

Solution

Meselson and Stahl conducted experiments on E. coli to prove that DNA replicates semiconservatively. Khorana discovered the synthesis of proteins. Watson and Crick designed the double helix model of DNA molecule.

Q34. In E. coli, transcription is terminated by

• 1) Rho factor
• 2) Transcriptional termination factor
• 3) Terminator protein
• 4) Alpha protein

Solution

In E. coli, transcription is terminated by a specific chain termination protein called the rho factor.

Q35. Which was the last human chromosome to be completely sequenced?

• 1) Chromosome 11
• 2) Chromosome 1
• 3) Chromosome 21
• 4) Chromosome X

Solution

Chromosome 1 is currently thought to have 4,316 genes, exceeding previous predictions based on its size. It was the last completed chromosome, sequenced two decades after the beginning of the Human Genome Project.  

Q36. DNA polymerases are generally used in DNA replication

• 1) For proofreading
• 2) For adding carbonyl compound
• 3) For breaking and joining pieces of one DNA strand
• 4) To cut the helix at certain places

Solution

Proofreading allows DNA polymerase to check each nucleotide during DNA synthesis and excise mismatched nucleotides in the 3´ to 5´ direction.

Q37. The prokaryotic enzyme which carries out the function of eukaryotic enzymes helicase and topoisomerase is

• 1) Gyrase
• 2) Replicase
• 3) Single-stranded DNA-binding protein
• 4) Helix-stabilising protein

Solution

The prokaryotic enzyme gyrase does the work of helicase and topoisomerase.

Q38. Transposons are

• 1) House-keeping genes
• 2) Jumping genes
• 3) Transporting genes
• 4) Stationary genes

Solution

After every cell division, a transposon copies itself and moves elsewhere, jumping at random to a new location on the chromosomes taking the genes with it. 

Q39. Give the site of protein synthesis. 

Solution

Ribosomes serve as the site for protein synthesis. Each ribosome consists of large and small subunits.

Q40. The lac operon consists of

• 1) Four regulatory genes only
• 2) Three regulatory genes and three structural genes
• 3) One regulatory gene and three structural genes
• 4) Two regulatory genes and two structural genes

Solution

Lac operon consists of one regulatory gene (i-gene) and three structural genes (lac-Z, lac-Y and lac-A).

Q41. DNA fingerprinting is also known as

• 1) DNA sequencing
• 2) DNA typing
• 3) DNA writing
• 4) DNA identification

Solution

DNA fingerprinting is also known as DNA typing or DNA profiling.

Q42. The coding segment of DNA is

• 1) Muton
• 2) Replicon
• 3) Intron
• 4) Exon

Solution

The coding sequences or expressed sequences are defined as exons which appear in mature or processed RNA. The exons are interrupted by introns.

Q43. While analysing the DNA of an organism, a total number of 5386 nucleotides were found out of which the proportion of different bases were Adenine = 29%, Guanine = 17%, Cytosine = 32% and Thymine = 17%. Considering the Chargaff’s rule, it can be concluded that

• 1) No conclusion can be drawn.
• 2) It is a double-stranded circular DNA.
• 3) It is single-stranded DNA.
• 4) It is a double-stranded linear DNA.

Solution

For single-stranded DNA molecule, A + T = G + C. However, the A-T base-pair has 2 hydrogen bonds and the G-C base-pair has 3 hydrogen bonds. The G-C interaction is therefore stronger (by about 30%) than A-T. It is a double-stranded circular DNA.

Q44. Which of the following is the correct sequence of the units of genetics arranged in descending order of size?

• 1) Gene → Cistron → Recon → Muton
• 2) Gene →Cistron →Muton →Recon
• 3) Gene →Muton → Cistron → Recon
• 4) Gene →Recon → Cistron →Muton

Solution

Gene size ranges from 20,000 to 50,000 base pairs. Cistron is a DNA strand/segment. Recon is the smallest section of a chromosome which is capable of recombination. Muton is the smallest element, which when altered leads to a mutation. 

Q45. The net electric charge on DNA and histones is

• 1) Both positive
• 2) Negative and positive, respectively
• 3) Zero
• 4) Both negative

Solution

Histones carry positive charge, because they have an abundance of basic proteins arginine and lysine. The negatively charged DNA is wrapped around positively charged histone resulting in a net positive and negative charge.

Q46. The inducer for switching 'on' the lac operon in bacteria is

• 1) Presence of sucrose
• 2) Presence of lactose
• 3) Number of bacteria
• 4) Presence of structural genes in the bacteria

Solution

There are two types of operons - inducible operons and repressible operons. The inducible operon is switched on when an inducer is present. When lactose is added to an E. coli culture, the structural genes produce mRNA which synthesises specific polypeptides on the ribosomes.

Q47. VNTR with respect to DNA stands for

• 1) Variable Number Transition Repeats
• 2) Variable Number Tandem Repeats
• 3) Variable Nucleotide Tandem Repeats
• 4) Variable Nucleotide Transition Repeats

Solution

VNTRs stands for Variable Number Tandem Repeats. VNTRs are like short tandem repeats but of a shortened sequence. They are inherited from parent to progeny and are used as genetic markers in parental identification.

Q48. The nitrogen bases of the DNA molecule are joined to the sugar moiety via

• 1) Glycosidic bonds
• 2) Hydrogen bonds
• 3) Peptide bonds
• 4) Phosphodiester bonds

Solution

The nitrogen bases are joined to the sugar molecule of the DNA via glycosidic bonds at an angle such that they project towards the inside of the DNA at 90°.

Q49. Retroviruses have genetic material

• 1) Either DNA or RNA only
• 2) DNA or RNA only
• 3) RNA only
• 4) DNA only

Solution

A retrovirus is an RNA virus which is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The genetic material of retroviruses consists of RNA instead of DNA.

Q50. Beadle and Tatum showed that each kind of mutant bread mould they studied lacked a specific enzyme. Their experiments demonstrated that

• 1) Genes are made up of DNA.
• 2) Genes carry information for making proteins.
• 3) Cells need specific enzymes in order to function.
• 4) Enzymes are required to repair damage.

Solution

Beadle and Tatum showed that hereditary represents genetically determined chemical reactions.

Q51. During splicing, the exons are joined and the enzyme which catalyses this reaction is

• 1) RNA ligase
• 2) RNA polymerase
• 3) RNA permease
• 4) RNA catalase

Solution

Ribonucleases cleave the RNA and ligases join the exons, and the enzyme responsible in splicing is RNA ligase.

Q52. How is peptide bond formed? 

Solution

Peptide bonds are formed in the ribosome during translation of the mRNA strand. Peptide bonds form by complementary base pairing of tRNA's anticodon with mRNA's codon.

Q53. The portion of DNA which contains information for an entire polypeptide is called

• 1) Operon
• 2) Muton
• 3) Recon
• 4) Cistron

Solution

A part of one chain of DNA molecule known as sense strand which codes a polypeptide is called a cistron. Each cistron consists of many codons, and a codon comprises three consecutive nitrogenous bases.

Q54. Semiconservative mode of replication of DNA was proved by

• 1) Meselson and Stahl
• 2) Griffith
• 3) Hershey and Chase
• 4) Watson and Crick

Solution

Meselson and Stahl proved that only one parent strand is conserved in each daughter molecule which is said to be semiconservative replication.

Q55. Which particular process was used by Meselson and Franklin in order to study the semi-conservative replication of DNA?  

• 1) Buoyant density centrifugation
• 2) Centrifugation
• 3) Density gradient centrifugation
• 4) Chromatography

Solution

Meselson and Stahl developed density-gradient centrifugation which can separate macromolecules exhibiting small differences in density.

Q56. DNA contains nucleobases, sugar and phosphate. Removal of which among these from a DNA sample will not significantly affect the length of DNA?

• 1) Phosphate
• 2) None of the above
• 3) Nucleobases
• 4) Sugar

Solution

According to the DNA structure, the vertical bars of the ladder are formed of alternating phosphate and deoxyribose sugar components. So, the nucleobases depend on the width of the DNA.

Q57. To initiate translation, the mRNA first binds to

• 1) The smaller ribosomal sub-unit
• 2) The whole ribosome
• 3) The larger ribosomal sub-unit
• 4) No such specificity exists

Solution

The first step of the initiation stage of translation is the binding of mRNA to the small ribosomal subunit through base pairing with appropriate sequences on rRNA.

Q58. Removal of the introns and joining of the exons in a defined order in a transcription unit is called

• 1) Splicing
• 2) Transformation
• 3) Tailing
• 4) Capping

Solution

Splicing is the modification of the ongoing process of synthesis of a polypeptide chain by removal of introns and joining of exons.

Q59. The study of migration patterns of human beings over a long period of time is known as

• 1) Genography
• 2) Demography
• 3) Population genetics
• 4) Migration prediction

Solution

The study of migration patterns of human beings over a long period of time is known as genography.

Q60. Control of gene expression takes place at the level of

• 1) Transcription
• 2) DNA replication
• 3) None of these
• 4) Translation

Solution

According to the central dogma of life, DNA is converted to RNA. So, DNA does not move to the site of protein synthesis to directly guide the process, instead it transfers its information to mRNA molecules which move to ribosomes to direct protein synthesis. Transcription is the first process of making a copy of genetic information stored in a DNA strand into a complementary strand of RNA.

Q61. Copying genetic information from one strand of DNA into RNA is

• 1) Transduction
• 2) Translation
• 3) Transformation
• 4) Transcription

Solution

DNA transcription is a process which involves transcribing genetic information from DNA to RNA.

Q62. Hargobind Khorana is known for

• 1) Discovery of DNA structure
• 2) Discovery of DNA ligase enzyme
• 3) Synthesis of protein
• 4) Discovery of tRNA

Solution

Hargobind Khorana’s synthetic nucleic acids caused protein synthesis just as in the cell; comparing these proteins with the nucleic acid showed which portions of the nucleic acid were the codes for each part of the protein. This shows how the genetic components of the cell nucleus control the synthesis of proteins.

Q63. Uracil is present in RNA at the place of

• 1) Guanine
• 2) Cytosine
• 3) Thymine
• 4) Adenine

Solution

Cytosine is common for both DNA and RNA, and thymine is present in DNA. Uracil is present in RNA at the place of thymine.

Q64. Hershey and Chase conducted an experiment on T2 phage using radioisotopes. What were their observations and conclusions? 

Solution

Hershey and Chase showed that the introduction of deoxyribonuclease (an enzyme which breaks down DNA) into a solution containing the labelled bacteriophages did not introduce any ³²P into the solution. This demonstrated that the phage is resistant to the enzyme while intact. Hershey and Chase concluded that DNA, not protein, was the genetic material. They determined that a protective protein coat was formed around the bacteriophage but that the internal DNA is what conferred its ability to produce progeny inside bacteria. 

Q65. During transcription, the DNA site at which RNA polymerase binds is called

• 1) Promoter
• 2) Regulator
• 3) Receptor
• 4) Enhancer

Solution

A promoter is a region of DNA which initiates transcription of a particular gene which is located towards the 5' end of the structural gene. RNA polymerase binds to the promoter region and by many transcription factors. Transcription factors and RNA polymerase bind to the promoter together forming a transcription initiation complex.

Q66. If the percentage of cytosine is 18%, then the percentage of adenine will be

• 1) 36%
• 2) 64%
• 3) 32%
• 4) 23%

Solution

The amount of adenine is always equal to that of thymine, and the amount of guanine is always equal to that of cytosine. 50% is the purine content and 50% is the pyrimidine content.

Q67. What are three major classes of RNA? Mention their functions.

Solution

The three major classes of RNA include tRNA, mRNA and rRNA. The function of tRNA is to transfer specific amino acids to a growing polypeptide chain during the ribosomal site of protein synthesis. The main function of the mRNA is to send the information of how to assemble the amino acids found to form protein in the ribosomes. rRNA are involved in protein synthesis.

Q68. RNA was synthesised out of a cell for the first time by

• 1) Stanley Prusiner
• 2) Ochoa
• 3) Watson
• 4) Stalk

Solution

The first in vitro synthesis of RNA was by Ochoa in 1967.

Q69. Which enzyme helps in proofreading of DNA?

• 1) Helicase
• 2) Replicase
• 3) Nuclease
• 4) Lipase

Solution

Nuclease is an enzyme which cleaves off mutated regions of the DNA molecule during proofreading.

Q70. Which of the following is a structural subunit of DNA?

• 1) RNA
• 2) Nucleotides
• 3) Protein
• 4) Carbohydrate

Solution

Nucleotides make up the structural subunit of DNA, which in turn makes three subunits - a phosphate group, a 5-carbon sugar (deoxyribose) and a nitrogen base.

Q71. The human chromosome which has the least number of functional genes is

• 1) Chromosome 1
• 2) Chromosome Y
• 3) Chromosome 12
• 4) Chromosome X

Solution

In the human chromosomes, chromosome 1 has the highest number of genes, while chromosome Y has the lowest number of genes.

Q72. In Hershey and Chase experiments, radioactive ³²P was used to culture bacteriophages which resulted in radioactive

• 1) Bacterial capsule
• 2) Protein capsule of bacteriophage
• 3) Viral DNA
• 4) Viral proteins

Solution

Hershey and Chase conducted the experiment by using radioactive P32 which proved that only the bacteriophage DNA enters the bacterial cell resulting in viral DNA.

Q73. The amino acid attaches to the tRNA at its

• 1) 3' end
• 2) 5' end
• 3) DHU loop
• 4) Anticodon site

Solution

In tRNA, a specific amino acid joins the 3' end of the molecule which is called the carrier end.

Q74. Transfer of DNA molecules separated in the gel by the process of electrophoresis onto a nylon sheet is known as

• 1) Southern blotting
• 2) Western blotting
• 3) Northern blotting
• 4) Eastern blotting

Solution

Southern blotting is a technique developed by E. M. Southern. In this technique, the DNA molecules separated by gel electrophoresis are transferred onto a nylon sheet.

Q75. Mutated microorganisms which can no longer produce a nutrient which the wild type microbe can produce are known as

• 1) Prototrophs
• 2) Heterotrophs
• 3) Auxotrophs
• 4) Neurotrophs

Solution

Wild-type microbes which can grow on minimal media and can produce all the necessary nutrients for their growth are known as prototrophs. Mutated microbes which can no longer produce a certain nutrient which the wild type microbe could produce and relies on an external source for their supply are known as auxotrophs.

Q76. Of the total amount of RNA, what is the amount of mRNA in a cell?

• 1) 50%
• 2) 10%
• 3) 5%
• 4) 72%

Solution

Of the total amount of RNA, mRNA forms about 5% of the total cellular RNA.

Q77. In genetic fingerprinting, the 'probe' refers to

• 1) A radioactively labelled single-stranded DNA molecule
• 2) A radioactively labelled single-stranded RNA molecule
• 3) A radioactively labelled double-stranded DNA molecule
• 4) A radioactively labelled double-stranded RNA molecule

Solution

The DNA probe is when one strand or a piece of DNA molecule is used in laboratory experiments. This is to search for the availability of a complementary sequence in a combination of different other single-stranded DNA molecules. In DNA fingerprinting, these probes are made radioactive. 

Q78. What is antisense technology?

• 1) Production of somaclonal variants in tissue culture.
• 2) RNA polymerase producing DNA.
• 3) When a piece of RNA which is complementary in sequence is used to stop expression of a specific gene.
• 4) A cell displaying a foreign antigen used for synthesis of antigenes.

Solution

A single-stranded RNA which is complementary mRNA is referred to as antisense RNA. Antisense technology includes inhibition of translation by using single-stranded nucleotide, any DNA or RNA sequences or even synthetic ones.

Q79. Write the names of various nitrogenous bases found in RNA. 

Solution

Adenine, Uracil, Guanine, Cytosine 

Q80. Name the enzyme involved in the continuous replication of DNA strand. Mention the polarity of the template strand. 

Solution

DNA-dependent DNA polymerase catalyses polymerisation only in one direction, i.e. the 5’-3’ direction, which creates additional complications at the replication fork. On one strand, the replication is continuous, while on the other, it is discontinuous.

Q81. Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a triplet?

• 1) Beadle and Tatum
• 2) Morgan and Sturtevant
• 3) Hershey and Chase
• 4) Nirenberg and Matthaei

Solution

Nirenberg and Matthaei cracked the first codon of the genetic code and showed that RNA controlled the production of specific types of protein.

Q82. Which of the following is not a requirement for the process of transcription?

• 1) DNA template
• 2) Mg²⁺
• 3) RNA polymerase
• 4) RNA primer

Solution

The process of transcription does not require the presence of a primer as RNA polymerase unlike DNA polymerase can synthesise an RNA molecule without the presence of a RNA primer.

Q83. Nitrogenous bases present in DNA:

• 1) Guanine, uracil
• 2) Adenine, guanine, cytosine, thymine
• 3) Adenine, guanine, cytosine, uracil
• 4) Adenine, thymine, uracil

Solution

The nitrogenous bases consist of purines (adenine, guanine) and pyrimidines (cytosine, thymine and uracil).

Q84. (a) Explain the functions of (i) Promoter (ii) tRNA and (iii) Exons. (b) Differentiate between mRNA and tRNA. 

Solution

(a) (i) The promoter region helps in binding of RNA polymerase to the DNA duplex by recognising the promoter by its sigma subunit in prokaryotes.  (ii) The function of tRNA is to transfer specific amino acids to a growing polypeptide chain during the ribosomal site of protein synthesis.  (iii) Exons are the parts of the gene which represent the codons for creating the protein. Exons are parts of DNA which are converted into mature mRNA. The process by which DNA is used as a template to create mRNA is called transcription. (b)  mRNA  tRNA (i) They are longer and linear in shape. (i) They are shorter and have a clover leaf-like structure. (ii) They carry information from DNA for protein synthesis. (ii) They carry amino acids to mRNA codons for protein synthesis. (iii) They are numerous in number. (iii) They are approximately 60 in number.  

Q85. Mention the two steps in activation of amino acid translation.  

Solution

(i) Binding of an amino acid with ATP requires enzymes called amino acyl RNA synthetases. (ii) Amino acid and ATP mediated by the enzyme form amino acyl-AMP-enzyme complex.

Q86. The codon-recognising step in translation uses energy in the form of 

• 1) ADP
• 2) ATP
• 3) GTP
• 4) GDP

Solution

In the codon-recognising step, the tRNA carrying the amino acid enters the A site of the ribosome and the anticodon on the tRNA attaches to the complementary codon on the mRNA molecule via hydrogen bonds. During this step, energy is used up in the form of GTP.

Q87. DNA replication requires the presence of which of the following ions?

• 1) Carbon
• 2) Magnesium
• 3) Nitrogen
• 4) Calcium

Solution

The replication of DNA requires DNA polymerase as well as the metal ions Mn⁺⁺ and Mg⁺⁺.

Q88. Which of the following steps in transcription is catalysed by RNA polymerase?

• 1) Elongation
• 2) Initiation
• 3) Termination
• 4) All of the above

Solution

RNA polymerase moves downstream, unwinding the DNA and elongating the RNA transcript from the 5' to 3' ends. In the wake of transcription, the DNA strands re-form a double helix. 

Q89. In which direction are the leading and lagging strands synthesised during DNA replication? Name the enzyme responsible for this process. 

Solution

The leading and lagging strands are synthesised at the corresponding 5′-3′ and 5′-3′ ends during DNA replication. DNA polymerase is responsible for this process.

Q90. DNA nucleotides are attached by

• 1) Van der Waals bond
• 2) Covalent bond
• 3) Electrovalent bond
• 4) Hydrogen bond

Solution

The bases in two strands are paired through hydrogen bond forming base pairs.

Q91. 1 nm = ____ Angstroms

• 1) 100
• 2) 1000
• 3) 1
• 4) 10

Solution

1 nm = 10 Angstroms

Q92. Give two important goals of the human genome project. 

Solution

(i) To determine the sequence present in the human genome. (ii) To identify the specific genes which cause genetic disorders.

Q93. Define Variable Number Tandem Repeats.

Solution

A tandem repeat from a single genetic locus in which the number of repeated DNA segments varies from individual to individual. It is used in DNA fingerprinting. 

Q94. The ‘S’ in the ribosomal subunits 40S and 60S stands for

• 1) Sedimentation value
• 2) Subunit
• 3) Svedberg unit
• 4) Separation unit

Solution

The ‘S’ in 40S and 60S represents the Svedberg unit of the ribosomal subunit, i.e. the time the subunit takes to move in centrifugal separation.

Q95. Which one of the following pairs of nitrogenous bases of nucleic acids is wrongly matched with the category mentioned against it?

• 1) Thymine, uracil- pyrimidines
• 2) Adenine, thymine - purines
• 3) Guanine, adenine - purines
• 4) Uracil, cytosine - pyrimidines

Solution

The purines consist of adenine and guanine, while the pyrimidines consist of thymine and cytosine. Thymine is replaced by uracil in RNA.

Q96. Identify a Mendelian disorder from the following;

• 1) Klinefelter's syndrome
• 2) Turner's syndrome
• 3) Phenylketonuria
• 4) Down's syndrome

Solution

Phenylketonuria is a single gene disorder which is caused by mutations in genes encoding enzyme proteins.

Q97.   What is promoter gene? 

Solution

The promoter gene is located adjacent to the operator gene, and it marks the site at which the RNA polymerase enzyme binds.

Q98. Eukaryotic polymerase δ corresponds to which prokaryotic enzyme?

• 1) DNA polymerase III
• 2) DNA polymerase I
• 3) RNA polymerase
• 4) DNA polymerase II

Solution

Eukaryotic polymerase δ corresponds to prokaryotic DNA polymerase III.

Q99. In the medium where E. coli was growing, lactose was added, which induced the lac operon. But why does the lac operon shut down after some time on addition of lactose in the medium?

Solution

In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it and induces transcription for the synthesis of the enzyme beta-galactosidase. After some time, when the level of the inducer increases, the repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped and the lac operon is shut down.

Q100. Differentiate between induction and repression. 

Solution

 Induction  Repression (i) It turns the operon on. (i) It turns the operon off. (ii) It starts transcription and translation. (ii) It stops transcription and translation. (iii) It operates in a catabolic pathway. (iii) It operates in an anabolic pathway.  

Q101. The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C.  

• 1) A - transcription B - translation C - Francis Crick
• 2) A - transcription B - replication C - James Watson
• 3) A - translation B - extension C - Rosalind Franklin
• 4) A - translation B - transcription C - Erwin Chargaff

Solution

The process of copying genetic information from the DNA strand to RNA is called transcription. Translation is the conversion from mRNA to protein. The process of formation of RNA from DNA and then protein is termed the central dogma of life, which was proposed by Francis Crick.

Q102. Which of the following does not serve as a raw material for the synthesis of an RNA molecule?

• 1) Cytidine triphosphate
• 2) Thymidine triphosphate
• 3) Adenosine triphosphate
• 4) Guanosine triphosphate

Solution

RNA molecules contain uracil in place of thymine, and hence, thymidine triphosphate does not serve as a raw material in the synthesis of an RNA molecule.

Q103. The first amino acid which is added to the polypeptide chain being synthesised in prokaryotes by the process of translation is

• 1) Methionine
• 2) Formylmethionine
• 3) Valine
• 4) Formaldehyde

Solution

The first amino acid added to the polypeptide chain being synthesised by translation is formylmethionine in prokaryotes and methionine in eukaryotes.

Q104. Initiation codon for methionine is

• 1) AAA
• 2) UUU
• 3) AUG
• 4) UAA

Solution

ATG and AUG denote sequences of DNA and RNA, respectively, which are the start codon or initiation codon encoding the amino acid methionine (Met) in eukaryotes and a modified Met (fMet) in prokaryotes.

Q105. The beginning of understanding genetic transformation in bacteria was made by

• 1) Frederick Griffith
• 2) T. H. Morgan
• 3) Watson and Crick
• 4) Hershey and Chase

Solution

Frederick Griffith witnessed genetic transformation in Streptococcus pneumoniae.

Q106. The sequence of one strand of DNA is written as follows: 5'- ATGCATGCATGCATGCATGCATGCATGC - 3'. Write down the sequence of the complementary strand in 5' ~ 3' direction.

Solution

5’- GCATGCATGCATGCATGCATGCATGCAT-3’.

Q107. In some viruses, DNA is synthesised by using RNA as a template. Such a DNA is called

• 1) r-DNA
• 2) c-DNA
• 3) A-DNA
• 4) B-DNA

Solution

c-DNA is DNA synthesised from a messenger RNA (mRNA) template in a reaction catalysed by the enzymes reverse transcriptase and DNA polymerase.

Q108. The Human Genome Project was officially launched on

• 1) 1^st October 1980
• 2) 1^st October 1990
• 3) 1^st December 1990
• 4) 1^st December 1980

Solution

The Human Genome Project was officially launched on 1^st October 1990 by the US Department of Energy and the National Institute of Health.

Q109. DNA replication occurs during which part of the cell cycle?

• 1) G₂ phase
• 2) Dividing phase
• 3) G₁ phase
• 4) S phase

Solution

The phases of the cell cycle are interphase, G0, G1, S phase, G2 and M phase. DNA replication occurs during the S phase. During the G1 phase, the cell chooses either to replicate its deoxyribonucleic acid (DNA) or to exit the cell cycle and enter a quiescent state (the G0 phase). The portion of interphase which follows the S phase is called the G2 phase. Some cells can exit the cell cycle from the G2 phase, just as they can from the G1 phase.

Q110. Repressor protein is produced by

• 1) Regulator gene
• 2) Operator gene
• 3) Structural gene
• 4) Promotor gene

Solution

The regulator gene controls the operator gene in cooperation with the inducer. This regulator gene codes for and produces a protein substance called repressor.

Q111. In E. coli, the lac operon gets switched on when

• 1) RNA polymerase binds to the operator
• 2) Lactose is present and it binds to RNA polymerase
• 3) Lactose is present and it binds to the repressor
• 4) Repressor binds to operator

Solution

The lac operon is an operon required for the transport and metabolism of lactose in Escherichia coli. With lactose in the cell, lactose binds to the repressor. This causes a structural change in the repressor, and it loses its affinity for the operator by which it is switched on.

Q112. The occurrence of which of the following diseases cannot be detected by the technique of DNA fingerprinting?

• 1) African sleeping sickness
• 2) Alzheimer
• 3) Cystic fibrosis
• 4) Haemophilia

Solution

African sleeping sickness is a parasitic disease. It does not affect the DNA of the individuals and hence cannot be detected by the technique of DNA fingerprinting.

Q113. (a) In a nucleus, the number of nucleoside triphosphates is 10 times the number of deoxyribonucleoside triphosphates but only deoxyribonucleotides are added during DNA replication. Suggest a mechanism. (b) Name few enzymes involved in DNA replication other than DNA polymerase and ligase.

Solution

(a) DNA polymerase can identify only deoxyribonucleoside triphosphates and is capable of incorporating them as deoxyribonucleotides. (b) Other than DNA polymerase and ligase, the enzymes involved in DNA replication are primase, gyrase and topoisomerase.

Q114. All individuals are unique from each other with respect to features, behaviour and nature. The amount of DNA which differs in all individuals to make them unique from the others is about

• 1) 25%
• 2) 10%
• 3) 80%
• 4) 50%

Solution

In an individual, about 90% of the DNA is similar and only 10% of the DNA differs from individual to individual.

Q115. List the various markers which are used in DNA fingerprinting. 

Solution

The various markers used in DNA fingerprinting are (i) Restriction endonucleases (ii) Satellite DNA (iii) Radioactive DNA probes

Q116. During DNA replication in prokaryotes, DNA is anchored to

• 1) Ribosome
• 2) Chromosome
• 3) Mesosome
• 4) Nucleolus

Solution

A mesosome helps to self-replicate bacterial DNA. When replicating, the two polynucleotide chains attach to the mesosome and then divide into two.

Q117. Explain briefly what is meant by DNA ~ RNA ~ protein. 

Solution

It is the central dogma of life in which genetic information flows from nucleic acids to protein. According to the central dogma, the flow of information takes place from DNA to RNA and from RNA to proteins.

Q118. A typical nucleosome contains

• 1) 400 bp of DNA helix
• 2) 100 bp of DNA helix
• 3) 200 bp of DNA helix
• 4) 300 bp of DNA helix

Solution

The nucleosome core particle consists of approximately 147 base pairs of DNA wrapped in superhelical turns around a histone octamer consisting of 2 copies each of the core histones H2A, H2B, H3 and H4 leading to 200 bp of DNA helix.

Q119. What are the functions of mRNA and tRNA? What anticodons will be required to recognise the following codons: (i) AAU, (ii) CGA, (iii) UAU and (iv) GCA?  

Solution

mRNA carries a message from DNA to ribosomes in the form of a sequence of triplet codes. It acts as a platform where protein synthesis takes place. tRNA transfers amino acids to the protein-synthesising apparatus. The anticodons are (i) UUA, (ii) GCU, (iii) AUA and (iv) CGU.

Q120. Retroviruses do not follow the central dogma. Comment.

Solution

The genomes of retroviruses are RNA, and they use the enzyme reverse transcriptase to make a DNA template. RNA --> DNA is the violation.

Q121. Explain (a) Cistron, (b) Operator gene and (c) Promoter gene.

Solution

(a) A segment of DNA which encodes for the formation of a specific polypeptide chain is called cistron. (b) An operator is a segment of DNA which a regulatory protein binds to. (c) A site in a DNA molecule at which RNA polymerase and transcription factors bind to initiate transcription of specific genes to mRNA.

Q122. Briefly describe bioinformatics.

Solution

Bioinformatics is the branch of science concerned with the management and analysis of biological information stored in databases. This branch developed after the establishment of genetic engineering techniques, introduction of automated protein and DNA sequencing technologies and the use of computers to store enormous data. This has led to the initiation of sequencing the human genome which was launched as the Human Genome Project.

Q123. The correctly matched pair is

• 1) RNA polymerase - RNA primer
• 2) Restriction endonuclease - genetic engineering
• 3) Central dogma - codon
• 4) Okazaki fragments - splicing

Solution

Okazaki fragments are short DNA segments which help in the replication of DNA. RNA polymerase is needed for constructing RNA chains from DNA genes as templates, a process called transcription. The central dogma states that genetic information flows in the following order: DNA-RNA-Protein. Restriction endonuclease is a cleaving enzyme which cleaves the DNA fragment of a chromosome into smaller DNA fragments and helps in recombinant DNA technology.

Q124. What do you understand by DNA polymorphism? 

Solution

DNA polymorphism is any difference in the nucleotide sequence between individuals. These differences can be single base pair changes, deletions or insertions of a given DNA sequence. SNPs (single nucleotide polymorphisms) are the most common type of DNA polymorphism in humans.

Q125. Z-DNA was discovered by

• 1) Watson and Crick
• 2) Alexander Rich
• 3) Pauling
• 4) Rosalind Franklin

Solution

Z-DNA was discovered by Alexander Rich in 1979. The Z-DNA molecule is found in the salivary gland polytene chromosomes.

Q126. Give two advantages of DNA fingerprinting. 

Solution

Two advantages of DNA fingerprinting are (i) It can solve the parental dispute of the offspring. (ii) It is used in crime scenes to check for DNA matching with the DNA of the suspect.

Q127. What is proofreading in DNA synthesis?

Solution

Proofreading in DNA synthesis is the property of certain polymerases, e.g. DNA polymerase, to remove erroneously introduced bases and to replace them with the correct bases.

Q128. Name the enzymes which can break and reseal the DNA strand.

Solution

Topoisomerases in eukaryotes and DNA gyrases in prokaryotes break and reseal the DNA strand.

Q129. What is it that forms the basis of DNA fingerprinting?

• 1) The relative difference in the DNA occurrence in blood, skin and saliva.
• 2) Satellite DNA occurring as highly repeated short DNA segments.
• 3) The relative proportions of purines and pyrimidines in DNA.
• 4) The relative amount of DNA in the ridges and grooves of the fingerprints.

Solution

DNA fingerprinting involves identifying differences in some specific regions in the DNA sequence called as repetitive DNA. Repetitive DNA is separated from bulk DNA. The bulk DNA forms a major peak and other small peaks are referred as satellite DNA. Satellite DNA occurs as highly repeated short DNA segments.

Q130. What is the difference between the function of primase and DNA polymerase? 

Solution

Primase catalyses the formation of a primer which is polyribonucleotide. It is the starting block during DNA replication. DNA polymerase polymerises the formation of DNA during DNA replication.

Q131. Where and when does replication occur?

Solution

Replication occurs in the nucleus during the S phase of the cell cycle in eukaryotes, and replication occurs continuously in prokaryotes.

Q132. Why does DNA replication start from the 5′ end?

Solution

DNA replication goes in the 5′ to 3′ direction because DNA polymerase acts on the 3′-OH of the existing strand for adding free nucleotides.

Q133. What are the two major functions of DNA?

Solution

(i) It provides for protein synthesis which allows growth and development of an organism. (ii) It replicates itself and provides each replicate a copy of itself to allow for protein synthesis.

Q134. List two essential roles for ribosome during translation.

Solution

Two essential roles for ribosome during translation are (i) Ribosome acts as the site where protein synthesis takes place from individual amino acids. (ii) Ribosome acts as a catalyst for forming a peptide bond (23S rRNA in bacteria acts as a ribozyme). 

Q135. What is a transcription unit?

Solution

The bases from the promoter to the terminator sites form a transcription unit.

Q136. A double-stranded DNA has 20% of cytosine. Calculate the percent of adenine in the DNA. Explain. 

Solution

In a DNA molecule, the number of cytosine molecules is equal to guanine molecules and the number of adenine molecules is equal to thymine molecules. Thus, if a double-stranded DNA has 20% cytosine, it has 20% guanine. Thus, C + G makes 40% of the total bases. The remaining 60% includes both adenine and thymine which are in equal amounts. So, the percentage of adenine is 30%.

Q137. A low level of expression of lac operon occurs all the time. Can you explain the logic behind this phenomenon? 

Solution

A low level of lac operon occurs due to the absence of formation of permeases. Permeases are necessary for the transport of lactose from medium into cells. Due to the failure of transport of lactose into the cell, it will not act as inducer.

Q138. According to Chargaff's rule, which one is correct?

• 1) All  of these
• 2) [A] + [T] = [G] + [C]
• 3) [A] + [G] = [T] + [C]
• 4) [A] + [C] = [G] + [T]

Solution

The purines and pyrimidines are always in equal amounts, i.e. A + G = T + C

Q139. Would it be appropriate to use DNA probes such as VNTR in DNA fingerprinting of a bacteriophage? 

Solution

The genome of a bacteriophage with all coding sequences is small. DNA fingerprinting is not done in bacteriophages because they do not have repetitive sequences like VNTRs in their genome.

Q140. (a) In the human genome, which one of the chromosomes has the most genes and which has the fewest? (b) Scientists have identified about 1.4 million single nucleotide polymorphs in the human genome. How is this information of their existence going to help scientists? 

Solution

(a) Chromosome 1 has the most genes (2968) and chromosome Y has the fewest genes (231). (b) Nucleotide polymorphs are used in DNA fingerprinting and mapping of the human genome.

Q141. Distinguish between a leading and lagging strand. 

Solution

Leading Strand  Lagging Strand 1. The replicated strand of DNA grows continuously without any gap. 1. The replicated strand of DNA is formed of short Okazaki fragments. 2. It is synthesised in the 5′-3′ direction. 2. It is synthesised in the 3′-5′ direction.  

Q142. Explain the dual function of AUG codon. Give the sequence of bases it is transcribed from and its anticodon. 

Solution

AUG codon has dual function because (i) It codes for the amino acid methionine (ii) It also acts as an initiator codon. The sequence of bases it is transcribed from is TAC. The sequence of bases in its anticodon is UAC.